Fth1 ftl1
WebDec 12, 2024 · National Center for Biotechnology Information WebJan 3, 2024 · To explore other target genes of BACH1 in the regulation of ferroptosis, we examined genes involved in the regulation of iron metabolism ( Fth1, Ftl1, Slc40a1, Tfrc, Mfn2, and Fxn ), heavy metal stress ( Mt1 ), and lipoperoxidation ( Gpx4 ). Some of these genes were up-regulated in response to erastin (see Fig. 1A ).
Fth1 ftl1
Did you know?
WebIn view of the influence of free iron on cell redox state, we noted with interest that expression of the genes (Ftl1 and Fth1) encoding the iron storage protein, ferritin, was induced to high ... WebFTH1 protein was also overexpressed in patient's samples and correlated with the in vitro cytotoxic activity of cytarabine. Lastly, we demonstrated that chemotherapy induced an …
WebThe ferritin subunits ferritin heavy chain (Fth1) and ferritin light chain (Ftl1) are tightly regulated at both the transcriptional and post-transcriptional levels. However, mechanisms of maintaining stable, basal expression of Fth1 are poorly understood. Here, we show that global deletion of Mbd5 in mice induces an iron overload phenotype. Webftl1 f: agggcgtaggccacttctt r: ctgggttttaccccattcatctt nm_010240.2 ptgs2 f: cacactgctggtcatcaagat r: tcactcctgtaatactggaggc nm_000963.4 slc11a2 f: caatgtctttgtcgtgtccgt ... fth1 ftl1 ftrc acsl4 lpcat3 ptgs2 gpx4 slc7a11 slc3a2 pearson correlation 1 .913 .871 .053 .662 .736 -.801 -.901 -.842
WebSep 21, 2024 · FTH1, a key subunit of ferritin, is involved in a variety of disease signaling pathways. In particular, the expression of FTH1 varies in different diseases. FTH1 was shown to regulate immunity in studies of prostate and breast cancer [37, 38]. FTH1 has been shown to inhibit apoptosis through the JNK signaling pathway activity . Ferritin heavy chain is a ferroxidase enzyme that in humans is encoded by the FTH1 gene. FTH1 gene is located on chromosome 11, and its mutation causes Hemochromatosis type 5.
WebFTH1 FTH1 Addgene Alerts Receive email alerts when new plasmids with this gene become available. Log in to subscribe to Addgene Alerts. Description ferritin heavy chain 1 Also known as FHC, FTH, FTHL6, HFE5, PIG15, PLIF Species Homo sapiens Entrez ID 2495
WebSep 28, 2024 · By forming a 24-mer spherical structure with ferritin L (FTL1) and ferritin H (FTH1) subunits, ferritin accommodates up to 4500 atoms of iron within its internal core [5]. Ferritin expression is translationally regulated by the labile iron pool via an iron response element (IRE) at the 5′-UTR of its transcripts. unfinished outdoor benchWebJan 24, 2024 · Interestingly, activation of NRF2 regulates iron-related genes such as FTH1, FTL1, SLC40A1, ABCB6, and HMOX1, which in turn promotes the synthesis of GSH synthesis, limits ROS production, and ... unfinished outdoor kitchen cabinetsWebUnited States Department of Transportation Federal Highway Administration. 1200 New Jersey Avenue, SE. Washington, DC 20590 unfinished outletWebApr 11, 2024 · The knockdown of ferritin heavy chain 1 (FTH1) facilitates iron overload–associated cardiomyopathy through ferroptosis . Ferroptotic stimuli themselves have been shown to induce the expression of prominin2 ... AML cells show increased expression of HO-1 and ferritin light chain 1 (FTL1), indicative of intracellular iron … unfinished oval wood framesWebDec 13, 2024 · The Fth1 hi cells exhibited higher expression in genes primarily associated with chemotaxis (Ccl3, Ccl4, Fpr1), pro-inflammatory cytokines (Il1a, Il12a, Tnf), … unfinished outdoor kitchen kitsWebThe FHL1 gene provides instructions for making three versions (isoforms) of a protein that plays an important role in muscles used for movement (skeletal muscles) and in the … unfinished padded guitar strapWebSep 22, 2024 · Although mammalian FTH1 and FTL proteins share significant sequence homology, they are functionally distinct [ [ 6] ]. FTH1 exhibits significant ferroxidase activity resulting from glutamic acid residues that serve as metal ligands [ [ 7]] and help in rapid iron uptake [ [ 8, 9] ]. unfinished outdoor kitchen island